Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pDN-D2irTNG4kwh
(Plasmid #44722)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44722 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA4/TO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5078
  • Total vector size (bp) 7446
  • Modifications to backbone
    CMV-2xTetO promoter replaced with pCMV-D2i promoter. Rabbit β-globin intron and WPRE inserted before and after insert, respectively.
  • Vector type
    Mammalian Expression, Synthetic Biology ; Expression regulator/reporter; Expression "Linearizer" system
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    pCMV-D2i promoter
  • Alt name
    Modified CMV-based synthetic promoter containing two tetO2 sites
  • Species
    Synthetic
  • Insert Size (bp)
    672
  • Mutation
    Initiator motif (Inr) displaced relative to pCMV-2xtetO (returned to its natural position). Two tetO2 sites flanking Inr motif.
  • Promoter pCMV-D2i

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site AflII (not destroyed)
  • 5′ sequencing primer Amp-R
  • 3′ sequencing primer Bglob-intron-R (TTTGCCCCCTCCATATAACA)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    htetR::NLS::EGFP
  • Alt name
    humanized tetracycline repressor
  • Alt name
    Simian virus 40 (SV40) large-T-antigen nuclear localization sequence
  • Alt name
    Enhanced green fluorescent protein
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    2481
  • Mutation
    Region around the ATG translation start codon converted to the consensus Kozak sequence; sequence optimized for mammalian codon bias
  • Tags / Fusion Proteins
    • Rabbit β-globin intron II (N terminal on insert)
    • WPRE (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer Bglob-intron-F (ctggtcatcatcctgccttt); CMV-F
  • 3′ sequencing primer EGFP-N; WPRE-R, BGH-rev
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Fragment containing humanized htetR gene from pTet-OFF Advanced plasmid (Clontech). Mammalian codon optimized variant of eGFP gene from the pIRES2-EGFP plasmid (Clontech). Rabbit β-globin intron II-containing fragment from plasmid pcDNA6/TR (Invitrogen). Fragment containing WPRE from plasmid pLVX-DD-tdTomato (Clontech). Modified CMV-based synthetic promoter pCMV-D2i synthesized de novo (Bio Basic Inc., Markham, Ontario, Canada).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDN-D2irTNG4kwh was a gift from Gabor Balazsi (Addgene plasmid # 44722 ; http://n2t.net/addgene:44722 ; RRID:Addgene_44722)
  • For your References section:

    Transferring a synthetic gene circuit from yeast to mammalian cells. Nevozhay D, Zal T, Balazsi G. Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471. 10.1038/ncomms2471 PubMed 23385595