TRS6E1b-luc(-732/-721) mutant 5
(Plasmid
#45388)
-
Depositing Lab
-
Depositing OrganizationUniversity of Michigan
Located in United States of America -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45388 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 45388-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 45388-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL2 basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5700
-
Modifications to backboneE1bTATA inserted upstream of luciferase
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name6 copies of hPAI-1 promoter -732/-721 mutated at -725/723
-
Alt nameTRS6 m5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)72
-
Mutation-725/-723 mutated from gtt to ccc
-
Tag
/ Fusion Protein
- luciferase
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho I (not destroyed)
- 3′ cloning site Hind III (not destroyed)
- 5′ sequencing primer TGTATCTTATGGTACTGTAACTG from Promega
- 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA from Promega
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 45388-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 45388-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRS6E1b-luc(-732/-721) mutant 5 was a gift from Thomas Gelehrter (Addgene plasmid # 45388 ; http://n2t.net/addgene:45388 ; RRID:Addgene_45388) -
For your References section:
Smad4/DPC4 and Smad3 mediate transforming growth factor-beta (TGF-beta) signaling through direct binding to a novel TGF-beta-responsive element in the human plasminogen activator inhibitor-1 promoter. Song CZ, Siok TE, Gelehrter TD. J Biol Chem. 1998 Nov 6;273(45):29287-90. 10.1074/jbc.273.45.29287 PubMed 9792626
Map uploaded by the depositor.
