Skip to main content

pFA1
(Plasmid #46789)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46789 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pYES2.1/V5-His/lacZ
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 8964
  • Total vector size (bp) 12690
  • Modifications to backbone
    The vector used for galactose-induced yeast expression of C-terminal double tagged (V5 and 6xHis) proteins was the pYES2.1/V5-His-TOPO (Invitrogen) and cloning was according to the manufacturer’s specifications. The identity of the cloned material was confirmed by restriction digestion analysis and DNA sequencing. PFA1 contains the full-length wild-type Fun30 sequence. The coding region of Fun30, including the 2 codons immediately upstream of the sequence and excluding the stop codon were amplified by polymerase chain reaction (PCR) from purified genomic DNA using the enzyme PfuUltra (Stratagene) following the manufacturer’s specifications. The primers used were: forward F30 (GTCGACGAAAACATGAGTGGTTCG) and reverse F30 (CTCGAGTTCTTTGGTTCCCTTCGG), which introduced a SalI and an XhoI restriction enzyme sites in the fragment amplified, in the 5’- and 3’- ends, respectively. 3’adenylation of the amplified fragments was done by PCR, after which the TOPO cloning reaction was performed.
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FUN30
  • Alt name
    YAL019W
  • Species
    S. cerevisiae (budding yeast)
  • Entrez Gene
    FUN30 (a.k.a. YAL019W)
  • Promoter PGAL1
  • Tag / Fusion Protein
    • V5 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal1 (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer T7
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFA1 was a gift from Patrick Varga-Weisz (Addgene plasmid # 46789 ; http://n2t.net/addgene:46789 ; RRID:Addgene_46789)
  • For your References section:

    The SNF2-family member Fun30 promotes gene silencing in heterochromatic loci. Neves-Costa A, Will WR, Vetter AT, Miller JR, Varga-Weisz P. PLoS One. 2009 Dec 1;4(12):e8111. doi: 10.1371/journal.pone.0008111. 10.1371/journal.pone.0008111 PubMed 19956593