Skip to main content

pFA3
(Plasmid #46790)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46790 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pYES2.1/V5-His/lacZ
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 8964
  • Total vector size (bp) 12690
  • Modifications to backbone
    The vector used for galactose-induced yeast expression of C-terminal double tagged (V5 and 6xHis) proteins was the pYES2.1/V5-His-TOPO (Invitrogen) and cloning was according to the manufacturer’s specifications. The identity of the cloned material was confirmed by restriction digestion analysis and DNA sequencing. PFA3 contains the ATPase-inactive version of Fun30, which carries a point mutation in the ATPase domain (Corona et al, 1999) that replaces lysine at position 603 (AAA) by arginine (AGA). The point mutation was introduced with the kit QuickChange XL Site-Directed Mutagenesis (Stratagene), according to the manufacturer’s specifications. The template was PFA1 and the primers were Mut forward (CGACATGGGTCTAGGTAGAACATGTCAAGTCATTTC) and Mut reverse (GAAATGACTTGACATGTTCTACCTAGACCCATGTCG).
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FUN30
  • Alt name
    YAL019W
  • Species
    S. cerevisiae (budding yeast)
  • Mutation
    ATP-binding site mutated replaced lysin 603 by arginine (AAA to AGA)
  • Entrez Gene
    FUN30 (a.k.a. YAL019W)
  • Promoter PGAL1
  • Tag / Fusion Protein
    • V5 (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal1 (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer T7
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFA3 was a gift from Patrick Varga-Weisz (Addgene plasmid # 46790 ; http://n2t.net/addgene:46790 ; RRID:Addgene_46790)
  • For your References section:

    The SNF2-family member Fun30 promotes gene silencing in heterochromatic loci. Neves-Costa A, Will WR, Vetter AT, Miller JR, Varga-Weisz P. PLoS One. 2009 Dec 1;4(12):e8111. doi: 10.1371/journal.pone.0008111. 10.1371/journal.pone.0008111 PubMed 19956593