pFA3
(Plasmid
#46790)
-
PurposeTo express ATPase inactive Fun30 in budding yeast
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 46790 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepYES2.1/V5-His/lacZ
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 8964
- Total vector size (bp) 12690
-
Modifications to backboneThe vector used for galactose-induced yeast expression of C-terminal double tagged (V5 and 6xHis) proteins was the pYES2.1/V5-His-TOPO (Invitrogen) and cloning was according to the manufacturer’s specifications. The identity of the cloned material was confirmed by restriction digestion analysis and DNA sequencing. PFA3 contains the ATPase-inactive version of Fun30, which carries a point mutation in the ATPase domain (Corona et al, 1999) that replaces lysine at position 603 (AAA) by arginine (AGA). The point mutation was introduced with the kit QuickChange XL Site-Directed Mutagenesis (Stratagene), according to the manufacturer’s specifications. The template was PFA1 and the primers were Mut forward (CGACATGGGTCTAGGTAGAACATGTCAAGTCATTTC) and Mut reverse (GAAATGACTTGACATGTTCTACCTAGACCCATGTCG).
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFUN30
-
Alt nameYAL019W
-
SpeciesS. cerevisiae (budding yeast)
-
MutationATP-binding site mutated replaced lysin 603 by arginine (AAA to AGA)
-
Entrez GeneFUN30 (a.k.a. YAL019W)
- Promoter PGAL1
-
Tag
/ Fusion Protein
- V5 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sal1 (not destroyed)
- 3′ cloning site Xho1 (not destroyed)
- 5′ sequencing primer T7
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFA3 was a gift from Patrick Varga-Weisz (Addgene plasmid # 46790 ; http://n2t.net/addgene:46790 ; RRID:Addgene_46790) -
For your References section:
The SNF2-family member Fun30 promotes gene silencing in heterochromatic loci. Neves-Costa A, Will WR, Vetter AT, Miller JR, Varga-Weisz P. PLoS One. 2009 Dec 1;4(12):e8111. doi: 10.1371/journal.pone.0008111. 10.1371/journal.pone.0008111 PubMed 19956593
Map uploaded by the depositor.