nes714tk/lacZ
(Plasmid #47614)

• Purpose: used to create transgenic mice expressing LacZ reporter with Nestin enhancer
• Depositing Lab: Urban Lendahl
• Depositing Organization: Karolinska Institutet
  Located in Sweden
• Publication: Lothian et al Eur J Neurosci. 1997 Mar;9(3):452-62.
• Citations: 1 Article

Backbone

• Vector backbone: SaStk/lacZ
• Backbone manufacturer: Clontech; modified by Lendahl lab
• Modifications to backbone: removed SalI site from pTKbeta and replaced HSV tk promoter with a basic HSV tk promoter containing SalI site.
• Vector type: enhancer reporter

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: nestin 2nd intron fragment
• Alt name: NES
• Species: H. sapiens (human)
• Insert Size (bp): 714
• Mutation: 714 bp from 3' end of 2nd intron
• Entrez Gene: NES (a.k.a. Nbla00170)
• Promoter: HSV tk promoter
• Tags / Fusion Proteins:
  • HSV tk promoter (C terminal on backbone)
  • lacZ (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: SaStk/lacZ 5 (gtcggggctggcttaactat)
• 3′ sequencing primer: LacZ-R

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

HindIII cleavage excises the complete enhancer-tk promoter-lacZ fragment from the vector. The lacZ gene can be removed from the SaStk/lacZ vector after cleavage with NotI.

DNA (Catalog # 47614-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 47614-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.