Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more


(Plasmid #38132)


This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38132 Standard format: Plasmid sent in bacteria as agar stab 1 $85


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 6269
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
    microphthalmia transcription factor, A variant
  • Alt name
    MITF variant 1
  • Species
    H. sapiens (human)
  • Mutation
    deleted stop codon
  • Entrez Gene
    MITF (a.k.a. CMM8, COMMAD, MI, MITF-A, WS2, WS2A, bHLHe32)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site KpnI (unknown if destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N1-MITF-A was a gift from Shawn Ferguson (Addgene plasmid # 38132 ; ; RRID:Addgene_38132)
  • For your References section:

    The Transcription Factor TFEB Links mTORC1 Signaling to Transcriptional Control of Lysosome Homeostasis. Roczniak-Ferguson A, Petit CS, Froehlich F, Qian S, Ky J, Angarola B, Walther TC, Ferguson SM. Sci Signal. 2012 Jun 12;5(228):ra42. 10.1126/scisignal.2002790 PubMed 22692423