Skip to main content

pAC-EsaR-I70V/D91G/V220A
(Plasmid #47647)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 47647 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pAC-EsaR
  • Backbone size w/o insert (bp) 3880
  • Total vector size (bp) 4652
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    esaR-I70V/D91G/V220A
  • Insert Size (bp)
    772
  • Mutation
    Changed Isoleucine 70 to Valine, Aspartic acid 91 to Glycine, and Valine 220 to Alanine
  • Promoter Plac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer gattacgcgcagaccaaaacgatc
  • 3′ sequencing primer gttgaaggctctcaagggcatcg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

esaR-I70V/D91G/V220A (750bp, indicated as lowercase letters in the partial sequence) is located between KpnI and BamHI sites in the same way as wt esaR in pAC-EsaR. Please see pAC-EsaR for lac promoter and terminator sequence information and plasmid map.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAC-EsaR-I70V/D91G/V220A was a gift from Cynthia Collins (Addgene plasmid # 47647 ; http://n2t.net/addgene:47647 ; RRID:Addgene_47647)
  • For your References section:

    Directed evolution of the quorum-sensing regulator EsaR for increased signal sensitivity. Shong J, Huang YM, Bystroff C, Collins CH. ACS Chem Biol. 2013 Apr 19;8(4):789-95. doi: 10.1021/cb3006402. Epub 2013 Feb 6. 10.1021/cb3006402 PubMed 23363022