Skip to main content

pBiFC-flag-hCaspase 2 FL (C303S)-VN173
(Plasmid #49258)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49258 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 49258-D50 50 μg of DNA in Tris buffer $495
DNA 49258-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pBiFC-VN173
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 5300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    caspase-2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1300
  • Mutation
    C303S
  • GenBank ID
    U13021
  • Entrez Gene
    CASP2 (a.k.a. CASP-2, ICH1, MRT80, NEDD-2, NEDD2, PPP1R57)
  • Promoter CMV
  • Tags / Fusion Proteins
    • split Venus N (C terminal on backbone)
    • flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer catggactacaaagacgatgac
  • 3′ sequencing primer gtccagctcgaccaggatgggc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBiFC-flag-hCaspase 2 FL (C303S)-VN173 was a gift from Douglas Green (Addgene plasmid # 49258 ; http://n2t.net/addgene:49258 ; RRID:Addgene_49258)
  • For your References section:

    Characterization of cytoplasmic caspase-2 activation by induced proximity. Bouchier-Hayes L, Oberst A, McStay GP, Connell S, Tait SW, Dillon CP, Flanagan JM, Beere HM, Green DR. Mol Cell. 2009 Sep 24;35(6):830-40. doi: 10.1016/j.molcel.2009.07.023. 10.1016/j.molcel.2009.07.023 PubMed 19782032