pBIFC-flag-hCaspase 2 prodomain-VN173
(Plasmid
#49262)
-
PurposeExpresses split fluorescence protein to measure caspase-2 dimerization in mammalian cells.
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49262 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBIFC-VN173
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4450
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecaspase-2 prodomain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)450
-
Mutationdelete aa 148-435
-
GenBank IDU13021
-
Entrez GeneCASP2 (a.k.a. CASP-2, ICH1, MRT80, NEDD-2, NEDD2, PPP1R57)
- Promoter CMV
-
Tags
/ Fusion Proteins
- flag (N terminal on backbone)
- split Venus N (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer catggactacaaagacgatgac
- 3′ sequencing primer gtccagctcgaccaggatgggc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBIFC-flag-hCaspase 2 prodomain-VN173 was a gift from Douglas Green (Addgene plasmid # 49262 ; http://n2t.net/addgene:49262 ; RRID:Addgene_49262) -
For your References section:
Characterization of cytoplasmic caspase-2 activation by induced proximity. Bouchier-Hayes L, Oberst A, McStay GP, Connell S, Tait SW, Dillon CP, Flanagan JM, Beere HM, Green DR. Mol Cell. 2009 Sep 24;35(6):830-40. doi: 10.1016/j.molcel.2009.07.023. 10.1016/j.molcel.2009.07.023 PubMed 19782032