pBiFC-HA-hCaspase 2 prodomain-VC155
(Plasmid
#49261)
-
PurposeExpresses split fluorescence protein to measure caspase-2 dimerization in mammalian cells.
-
Depositing Lab
-
Depositing OrganizationSt. Jude Children's Research Hospital
Located in United States of America -
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49261 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 49261-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 49261-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepBiFC-NC155
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4450
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecaspase-2 prodomain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)450
-
Mutationdelete aa 148-435
-
GenBank IDU13021
-
Entrez GeneCASP2 (a.k.a. CASP-2, ICH1, MRT80, NEDD-2, NEDD2, PPP1R57)
- Promoter CMV
-
Tags
/ Fusion Proteins
- HA (N terminal on backbone)
- split Venus C (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer atgtacccatacgatgttccag
- 3′ sequencing primer tgcttgtcgtggttcatgac
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 49261-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 49261-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBiFC-HA-hCaspase 2 prodomain-VC155 was a gift from Douglas Green (Addgene plasmid # 49261 ; http://n2t.net/addgene:49261 ; RRID:Addgene_49261) -
For your References section:
Characterization of cytoplasmic caspase-2 activation by induced proximity. Bouchier-Hayes L, Oberst A, McStay GP, Connell S, Tait SW, Dillon CP, Flanagan JM, Beere HM, Green DR. Mol Cell. 2009 Sep 24;35(6):830-40. doi: 10.1016/j.molcel.2009.07.023. 10.1016/j.molcel.2009.07.023 PubMed 19782032