Skip to main content

pmirGLO-Bmpr2-1719
(Plasmid #49379)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49379 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 49379-D50 50 μg of DNA in Tris buffer $495
DNA 49379-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pmirGLO
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 7350
  • Total vector size (bp) 7377
  • Modifications to backbone
    For cloning oligonucleotides into pmirGLO, bp 7314-7331 were excised (region between PmeI and XbaI).
  • Vector type
    Luciferase
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    N/A
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bmpr2
  • Species
    H. sapiens (human), M. musculus (mouse)
  • Insert Size (bp)
    45
  • GenBank ID
    NM_001204
  • Entrez Gene
    BMPR2 (a.k.a. BMPR-II, BMPR3, BMR2, BRK-3, POVD1, PPH1, T-ALK)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GAAGCTGAGTTGGCTGCT
  • 3′ sequencing primer CACTGCATTCTAGTTGTGGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmirGLO-Bmpr2-1719 was a gift from Martine Roussel (Addgene plasmid # 49379 ; http://n2t.net/addgene:49379 ; RRID:Addgene_49379)
  • For your References section:

    Silencing of the miR-17~92 cluster family inhibits medulloblastoma progression. Murphy BL, Obad S, Bihannic L, Ayrault O, Zindy F, Kauppinen S, Roussel MF. Cancer Res. 2013 Oct 21. 10.1158/0008-5472.CAN-13-0927 PubMed 24145352