Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pIRESneo-FLAG/HA Ago2 corrected
(Plasmid #10822)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 10822 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pIRESneo
  • Backbone size w/o insert (bp) 5310
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Argonaute 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2580
  • Mutation
    3 silent mutations in orf
  • GenBank ID
    NM_012154
  • Entrez Gene
    AGO2 (a.k.a. CASC7, EIF2C2, LESKRES, LINC00980, PPD, Q10)
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ggtaccgagctcggatcgat
  • 3′ sequencing primer agctgttggggtgagtactcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIRESneo-FLAG/HA Ago2 corrected was a gift from Thomas Tuschl (Addgene plasmid # 10822 ; http://n2t.net/addgene:10822 ; RRID:Addgene_10822)
  • For your References section:

    Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G, Tuschl T. Mol Cell. 2004 Jul 23. 15(2):185-97. 10.1016/j.molcel.2004.07.007 PubMed 15260970