pCMV-myc-Rem2 L317G
(Plasmid
#51586)
-
Purposeexpresses RNAiR myc-tagged Rem2 non-CaM interacting
-
Depositing Lab
-
Depositing OrganizationBrandeis University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 51586 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRem2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1000
-
MutationL317G; silent mutations at shRNA 1 and 2 recognition sites (approx. AA 143-160)
-
Entrez GeneRem2 (a.k.a. AW411893)
- Promoter CMV
-
Tag
/ Fusion Protein
- myc (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer GATCCGGTACTAGAGGAACTGAAAAAC
- 3′ sequencing primer CATTCTAGTTGTGGTTTGTCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the sequence of the myc epitope tag in this plasmid is MQKLISEEDLL, which differs from the standard EQKLISEEDLL.
The Rem2 insert in this plasmid contains T13I and T15I mutations when compared to GenBank reference sequence NP_542764.2.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-myc-Rem2 L317G was a gift from Suzanne Paradis (Addgene plasmid # 51586 ; http://n2t.net/addgene:51586 ; RRID:Addgene_51586) -
For your References section:
The GTPase Rem2 regulates synapse development and dendritic morphology. Ghiretti AE, Paradis S. Dev Neurobiol. 2011 May;71(5):374-89. doi: 10.1002/dneu.20868. 10.1002/dneu.20868 PubMed 21485012