Skip to main content
Addgene
Open Menu

pCAG-hGPR56-IRES-GFP
(Plasmid #52297)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52297 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 52297-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 52297-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCAGIG
  • Backbone size w/o insert (bp) 6135
  • Total vector size (bp) 8222
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human GPR56 coding sequence
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2082
  • Entrez Gene
    ADGRG1 (a.k.a. BFPP, BPPR, GPR56, TM7LN4, TM7XN1)
  • Promoter CAG promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (destroyed during cloning)
  • 3′ cloning site EcoRV (destroyed during cloning)
  • 5′ sequencing primer TGTGACCGGCGGCTCTAGAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-hGPR56-IRES-GFP was a gift from Christopher A Walsh (Addgene plasmid # 52297 ; http://n2t.net/addgene:52297 ; RRID:Addgene_52297)

  • For your References section:

    Evolutionarily dynamic alternative splicing of GPR56 regulates regional cerebral cortical patterning. Bae BI, Tietjen I, Atabay KD, Evrony GD, Johnson MB, Asare E, Wang PP, Murayama AY, Im K, Lisgo SN, Overman L, Sestan N, Chang BS, Barkovich AJ, Grant PE, Topcu M, Politsky J, Okano H, Piao X, Walsh CA. Science. 2014 Feb 14;343(6172):764-8. doi: 10.1126/science.1244392. 10.1126/science.1244392 PubMed 24531968
Related items:
Commonly requested with: