-
PurposeFor expression of METTL3 (methyltransferase-like 3) in human cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Chicago
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53739 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5446
- Total vector size (bp) 7125
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMethyltransferase-like 3
-
Alt nameMETTL3
-
Alt nameMTA-70
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1743
-
GenBank IDNM_019852.3
-
Entrez GeneMETTL3 (a.k.a. IME4, M6A, MT-A70, Spo8, hMETTL3)
- Promoter T7
-
Tag
/ Fusion Protein
- FLAG tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Hind III (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer 5' TAATACGACTCACTATAGGG 3'
- 3′ sequencing primer 5' ATTTAGGTGACACTATAG 3'
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bycDNA was obtained from Open Biosystems
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3/Flag-METTL3 was a gift from Chuan He (Addgene plasmid # 53739 ; http://n2t.net/addgene:53739 ; RRID:Addgene_53739) -
For your References section:
A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Liu J, Yue Y, Han D, Wang X, Fu Y, Zhang L, Jia G, Yu M, Lu Z, Deng X, Dai Q, Chen W, He C. Nat Chem Biol. 2014 Feb;10(2):93-5. doi: 10.1038/nchembio.1432. Epub 2013 Dec 6. 10.1038/nchembio.1432 PubMed 24316715