-
Purposefull length YTHDF2 with N-terminal flag tag for mammalian cell expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52300 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5446
- Total vector size (bp) 7152
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameYTHDF2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1767
-
GenBank IDNM_001173128
-
Entrez GeneYTHDF2 (a.k.a. CAHL, DF2, HGRG8, NY-REN-2)
- Promoter T7
-
Tag
/ Fusion Protein
- flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer 5' TAATACGACTCACTATAGGG 3'
- 3′ sequencing primer 5' ATTTAGGTGACACTATAG 3' (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original YTHDF2 cDNA sequence was purchased from Open Biosystems (MHS1011-59135).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-flag-YTHDF2 was a gift from Chuan He (Addgene plasmid # 52300 ; http://n2t.net/addgene:52300 ; RRID:Addgene_52300) -
For your References section:
N6-methyladenosine-dependent regulation of messenger RNA stability. Wang X, Lu Z, Gomez A, Hon GC, Yue Y, Han D, Fu Y, Parisien M, Dai Q, Jia G, Ren B, Pan T, He C. Nature. 2014 Jan 2;505(7481):117-20. doi: 10.1038/nature12730. Epub 2013 Nov 27. 10.1038/nature12730 PubMed 24284625