pMIR-His-Halo-Tev-PTEN
(Plasmid
#58241)
-
Purposeexpresses halo tagged PTEN protein
-
Depositing Lab
-
Depositing OrganizationCornell University
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58241 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 58241-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 58241-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMIR
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 6470
- Total vector size (bp) 8606
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namephosphatase and tensin homolog
-
Alt namePTEN
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2136
-
GenBank IDNM_000314.4
-
Entrez GenePTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, PTENgama, TEP1)
- Promoter CMV
-
Tag
/ Fusion Protein
- His-Halo-Tev (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAGGAAACAGCTATGAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Aye, Y.; Brignole, E. J.; Long, M. J. C.; Chitturulu, J.; Drennan, C. L.; Asturias, F. J.;
Stubbe J. Chem. Biol. 2012, 19, 799-805
Yen, H-C.S., Xu, Q., Chou, D.M., Zhao, Z., and Elledge, S.J. (2008). Global protein stability
profiling in mammalian cells. Science 322, 918−923.
DNA (Catalog # 58241-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 58241-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMIR-His-Halo-Tev-PTEN was a gift from Yimon Aye (Addgene plasmid # 58241 ; http://n2t.net/addgene:58241 ; RRID:Addgene_58241) -
For your References section:
Temporally controlled targeting of 4-hydroxynonenal to specific proteins in living cells. Fang X, Fu Y, Long MJ, Haegele JA, Ge EJ, Parvez S, Aye Y. J Am Chem Soc. 2013 Oct 2;135(39):14496-9. doi: 10.1021/ja405400k. Epub 2013 Sep 18. 10.1021/ja405400k PubMed 24015839