-
PurposeLentiviral vector to express p38 KTR mCerulean3 under CMV promoter (With Puromycin Resistance)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59155 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLenti CMV Puro DEST (w118-1)
-
Backbone manufacturerEric Campeau Lab (Addgene Plasmid 17452)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namep38 Kinase Translocation Reporter
-
Alt namep38
-
Alt nameMAPK14 mitogen-activated protein kinase 14
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Entrez GeneMAPK14 (a.k.a. CSBP, CSBP1, CSBP2, CSPB1, EXIP, Mxi2, PRKM14, PRKM15, RK, SAPK2A, p38, p38ALPHA)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCerulean3
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCMV Puro DEST p38KTRmCerulean3 was a gift from Markus Covert (Addgene plasmid # 59155 ; http://n2t.net/addgene:59155 ; RRID:Addgene_59155) -
For your References section:
High-sensitivity measurements of multiple kinase activities in live single cells. Regot S, Hughey JJ, Bajar BT, Carrasco S, Covert MW. Cell. 2014 Jun 19;157(7):1724-34. doi: 10.1016/j.cell.2014.04.039. 10.1016/j.cell.2014.04.039 PubMed 24949979