Skip to main content

p201N Cas9
(Plasmid #59175)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59175 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 59175-D50 50 μg of DNA in Tris buffer $495
DNA 59175-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pPZP
  • Backbone size w/o insert (bp) 6200
  • Total vector size (bp) 14349
  • Modifications to backbone
    Inclusion of aph gene for bacterial selection on kanamycin.
  • Vector type
    CRISPR
  • Selectable markers
    G418, kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Alt name
    Cas9 human-codon optimized
  • Species
    Synthetic
  • Insert Size (bp)
    5265
  • Promoter 2x35S

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site I-SceI (not destroyed)
  • 3′ cloning site I-SceI (not destroyed)
  • 5′ sequencing primer ACATGCACCTAATTTCACTAGATGT
  • 3′ sequencing primer TGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    nptII
  • Species
    E. coli
  • Insert Size (bp)
    2184
  • Promoter StUbi-3P

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer AGCGGATAACAATTTCACACAGGA
  • 3′ sequencing primer GCAGAGCTTACACTCTCATTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p201N Cas9 was a gift from Wayne Parrott (Addgene plasmid # 59175 ; http://n2t.net/addgene:59175 ; RRID:Addgene_59175)
  • For your References section:

    Targeted genome modifications in soybean with CRISPR/Cas9. Jacobs TB, LaFayette PR, Schmitz RJ, Parrott WA. BMC Biotechnol. 2015 Mar 12;15:16. doi: 10.1186/s12896-015-0131-2. 10.1186/s12896-015-0131-2 PubMed 25879861