p201H Cas9
(Plasmid #59176)

• Purpose: Cas9 driven by double 35S, hygromycin resistance for plant selection, I-PpoI site to accept gRNA from pUC gRNA Shuttle
• Depositing Lab: Wayne Parrott
• Depositing Organization: University of Georgia
  Located in United States of America
• Publication: Jacobs et al BMC Biotechnol. 2015 Mar 12;15:16. doi: 10.1186/s12896-015-0131-2.
• Citations: 5 Articles

Backbone

• Vector backbone: pPZP
• Backbone size w/o insert (bp): 6200
• Total vector size (bp): 14587
• Modifications to backbone: Inclusion of aph gene for bacterial selection on kanamycin.
• Vector type: CRISPR
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Cas9
• Alt name: Cas9 human-codon optimized
• Species: Synthetic
• Insert Size (bp): 5265
• Promoter: 2x35S

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: I-SceI (not destroyed)
• 3′ cloning site: I-SceI (not destroyed)
• 5′ sequencing primer: ACATGCACCTAATTTCACTAGATGT
• 3′ sequencing primer: TGTAAAACGACGGCCAGT

Gene/Insert 2

• Gene/Insert name: hph
• Alt name: hygromycin resistance
• Species: E. coli
• Insert Size (bp): 2417
• Promoter: StUbi-3P

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: PacI (not destroyed)
• 5′ sequencing primer: GCAGAGCTTACACTCTCATTC
• 3′ sequencing primer: AGCGGATAACAATTTCACACAGGA

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 59176-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 59176-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.