Skip to main content
Addgene
Open Menu

pNSEN-d2
(Plasmid #59763)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59763 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 59763-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 59763-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pUC
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    d2-EGFP
  • Alt name
    destablized EGFP
  • Insert Size (bp)
    935
  • Promoter SV40 promoter
  • Tags / Fusion Proteins
    • 3X NLS (N terminal on insert)
    • PEST (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer GACGAAAGATTGGTGTGGAAAGTCC
  • 3′ sequencing primer atcatcctgctcctccacctcc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Tomato
  • Alt name
    monomeric Tomato
  • Insert Size (bp)
    785
  • Promoter CMV promoter
  • Tag / Fusion Protein
    • 3X NLS (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer CACTGCAATCTCGTGATACGCCTA
  • 3′ sequencing primer tgatgagtttggacaaaccacaac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNSEN-d2 was a gift from Jerry Crabtree (Addgene plasmid # 59763 ; http://n2t.net/addgene:59763 ; RRID:Addgene_59763)

  • For your References section:

    MicroRNA-mediated switching of chromatin-remodelling complexes in neural development. Yoo AS, Staahl BT, Chen L, Crabtree GR. Nature. 2009 Jul 30;460(7255):642-6. doi: 10.1038/nature08139. Epub 2009 Jun 28. 10.1038/nature08139 PubMed 19561591
Related items:
Commonly requested with: