GFP-APPL1-ΔPTB
(Plasmid
#59768)
-
PurposeExpresses APPL1 with PTB domain deleted
-
Depositing Lab
-
Depositing OrganizationVanderbilt University
Located in United States of America -
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59768 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 59768-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 59768-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepIRES2
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAPPL1
-
SpeciesH. sapiens (human)
-
Mutationdeleted amino acids 467-709
-
GenBank IDNM_012096.2
-
Entrez GeneAPPL1 (a.k.a. APPL, DIP13alpha, MODY14)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tcgaattcggcttatgccgg
- 3′ sequencing primer taggtacccaggctgatcttcacacac
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 59768-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 59768-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-APPL1-ΔPTB was a gift from Donna Webb (Addgene plasmid # 59768 ; http://n2t.net/addgene:59768 ; RRID:Addgene_59768) -
For your References section:
The endosomal adaptor protein APPL1 impairs the turnover of leading edge adhesions to regulate cell migration. Broussard JA, Lin WH, Majumdar D, Anderson B, Eason B, Brown CM, Webb DJ. Mol Biol Cell. 2012 Apr;23(8):1486-99. doi: 10.1091/mbc.E11-02-0124. Epub 2012 Feb 29. 10.1091/mbc.E11-02-0124 PubMed 22379109