Skip to main content

pENTR D-TOPO-C3_25
(Plasmid #60268)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60268 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pENTR/D-TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2580
  • Vector type
    Gateway Cloning

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ROCK1 enhancer
  • Alt name
    ROCK1
  • Species
    H. sapiens (human)
  • Entrez Gene
    ROCK1 (a.k.a. P160ROCK, ROCK-I)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

chromosome : chr18; start: 17001455 end: 17002128 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCGAAGGGCAGAGAGGAGCA Rv primer used for cloning: TCTTCTGTGGCACATGGTGGGCTA

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR D-TOPO-C3_25 was a gift from Jorge Ferrer (Addgene plasmid # 60268 ; http://n2t.net/addgene:60268 ; RRID:Addgene_60268)
  • For your References section:

    Pancreatic islet enhancer clusters enriched in type 2 diabetes risk-associated variants. Pasquali L, Gaulton KJ, Rodriguez-Segui SA, Mularoni L, Miguel-Escalada I, Akerman I, Tena JJ, Moran I, Gomez-Marin C, van de Bunt M, Ponsa-Cobas J, Castro N, Nammo T, Cebola I, Garcia-Hurtado J, Maestro MA, Pattou F, Piemonti L, Berney T, Gloyn AL, Ravassard P, Gomez-Skarmeta JL, Muller F, McCarthy MI, Ferrer J. Nat Genet. 2014 Feb;46(2):136-43. doi: 10.1038/ng.2870. Epub 2014 Jan 12. 10.1038/ng.2870 PubMed 24413736