Skip to main content

LV-TRE-WT human MyoD-T2A-dsRedExpress2
(Plasmid #60628)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60628 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pRRL
  • Backbone size w/o insert (bp) 10000
  • Total vector size (bp) 10971
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VP64 mouse MyoD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    960
  • GenBank ID
    NM_002478.4
  • Entrez Gene
    MYOD1 (a.k.a. CMYO17, CMYP17, MYF3, MYOD, MYODRIF, PUM, bHLHc1)
  • Promoter TRE

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NsiI (not destroyed)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer tacggtgggaggcctatataagca
  • 3′ sequencing primer TCTGGGTGCCCTCGTAGGGCTT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the Addgene verified sequence only finds 5 of the 7 repeated TetO sequences. It may exhibit lower expression of MyoD-T2A-dsRedExpress2 compared to plasmids with the full TetO array (7x repeats).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LV-TRE-WT human MyoD-T2A-dsRedExpress2 was a gift from Charles Gersbach (Addgene plasmid # 60628 ; http://n2t.net/addgene:60628 ; RRID:Addgene_60628)
  • For your References section:

    Enhanced MyoD-Induced Transdifferentiation to a Myogenic Lineage by Fusion to a Potent Transactivation Domain. Kabadi AM, Thakore PI, Vockely CM, Ousterout DG, Gibson TM, Guilak F, Reddy TE, Gersbach CA. ACS Synth Biol. 2014 Dec 10. 10.1021/sb500322u PubMed 25494287