-
PurposeExpresses WT human MyoD and dsRedExpress2 in response to doxycycline
-
Depositing Lab
-
Depositing OrganizationDuke University
Located in the United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60628 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRRL
- Backbone size w/o insert (bp) 10000
- Total vector size (bp) 10971
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVP64 mouse MyoD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)960
-
GenBank IDNM_002478.4
-
Entrez GeneMYOD1 (a.k.a. CMYO17, CMYP17, MYF3, MYOD, MYODRIF, PUM, bHLHc1)
- Promoter TRE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NsiI (not destroyed)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer tacggtgggaggcctatataagca
- 3′ sequencing primer TCTGGGTGCCCTCGTAGGGCTT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that the Addgene verified sequence only finds 5 of the 7 repeated TetO sequences. It may exhibit lower expression of MyoD-T2A-dsRedExpress2 compared to plasmids with the full TetO array (7x repeats).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LV-TRE-WT human MyoD-T2A-dsRedExpress2 was a gift from Charles Gersbach (Addgene plasmid # 60628) -
For your References section:
Enhanced MyoD-Induced Transdifferentiation to a Myogenic Lineage by Fusion to a Potent Transactivation Domain. Kabadi AM, Thakore PI, Vockely CM, Ousterout DG, Gibson TM, Guilak F, Reddy TE, Gersbach CA. ACS Synth Biol. 2014 Dec 10. 10.1021/sb500322u PubMed 25494287