-
PurposeMammalian expression vector for human KCC2 under CAG promoter. Coexpression of TdTomato with IRES sequence
-
Depositing Lab
-
Depositing OrganizationUniversity of North Carolina at Chapel Hill
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61404 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 61404-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 61404-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCITF
- Backbone size w/o insert (bp) 6900
- Total vector size (bp) 10292
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKCC2
-
Alt nameSLC12A5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3351
-
GenBank IDAAG43493.1 AF208159.1
-
Entrez GeneSLC12A5 (a.k.a. EIEE34, EIG14, KCC2, hKCC2)
- Promoter CAG
-
Tag
/ Fusion Protein
- IRES-tdTomato-Flag (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer CTACAGCTCCTGGGCAACGT
- 3′ sequencing primer CGGCTTCGGCCAGTAACG
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 61404-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 61404-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCITF-KCC2 was a gift from Franck Polleux (Addgene plasmid # 61404 ; http://n2t.net/addgene:61404 ; RRID:Addgene_61404) -
For your References section:
KCC2 expression promotes the termination of cortical interneuron migration in a voltage-sensitive calcium-dependent manner. Bortone D, Polleux F. Neuron. 2009 Apr 16;62(1):53-71. doi: 10.1016/j.neuron.2009.01.034. 10.1016/j.neuron.2009.01.034 PubMed 19376067