Skip to main content

pEFIRES NQO1 WT
(Plasmid #61735)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61735 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 61735-D50 50 μg of DNA in Tris buffer $495
DNA 61735-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEFIRES
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NAD(P)H dehydrogenase, quinone 1 (NQO1)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    825
  • Mutation
    wild type
  • GenBank ID
    NM_000903.2 NP_000894.1
  • Entrez Gene
    NQO1 (a.k.a. DHQU, DIA4, DTD, NMOR1, NMORI, QR1)
  • Promoter EF1a
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGTTTCTGATAGGCACCTATTGC
  • 3′ sequencing primer CCTTATTCCAAGCGGCTTCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEFIRES NQO1 WT was a gift from Yosef Shaul (Addgene plasmid # 61735 ; http://n2t.net/addgene:61735 ; RRID:Addgene_61735)
  • For your References section:

    A mechanism of ubiquitin-independent proteasomal degradation of the tumor suppressors p53 and p73. Asher G, Tsvetkov P, Kahana C, Shaul Y. Genes Dev. 2005 Feb 1;19(3):316-21. 10.1101/gad.319905 PubMed 15687255