pEFIRES NQO1 WT
(Plasmid
#61735)
-
PurposeExpresses WT human NQO1
-
Depositing Lab
-
Depositing OrganizationWeizmann Institute of Science
Located in Israel -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61735 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 61735-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 61735-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEFIRES
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNAD(P)H dehydrogenase, quinone 1 (NQO1)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)825
-
Mutationwild type
-
GenBank IDNM_000903.2 NP_000894.1
-
Entrez GeneNQO1 (a.k.a. DHQU, DIA4, DTD, NMOR1, NMORI, QR1)
- Promoter EF1a
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGTTTCTGATAGGCACCTATTGC
- 3′ sequencing primer CCTTATTCCAAGCGGCTTCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 61735-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 61735-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEFIRES NQO1 WT was a gift from Yosef Shaul (Addgene plasmid # 61735 ; http://n2t.net/addgene:61735 ; RRID:Addgene_61735) -
For your References section:
A mechanism of ubiquitin-independent proteasomal degradation of the tumor suppressors p53 and p73. Asher G, Tsvetkov P, Kahana C, Shaul Y. Genes Dev. 2005 Feb 1;19(3):316-21. 10.1101/gad.319905 PubMed 15687255