Skip to main content

pcDNA3.1-CHRFAM7A
(Plasmid #62284)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 62284 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
DNA 62284-D50 50 μg of DNA in Tris buffer $495 *
DNA 62284-D100 100 μg of DNA in Tris buffer $585 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 8000
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CHRFAM7A
  • Alt name
    dhAlpha7
  • Alt name
    Human Alpha7 neuronal nicotinic acetylcholine receptor gene with partial duplication
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1638
  • Mutation
    partial duplication of CHRNA7
  • GenBank ID
    89832 NM_139320.1
  • Entrez Gene
    CHRFAM7A (a.k.a. CHRNA7, CHRNA7-DR1, D-10, NACHRA7)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTCGGTGCCCCTTGCCATTT
  • 3′ sequencing primer CCTTGCCCATCTGTGAGTTTTCCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Sherry Leonard Department of Psychiatry, University of Colorado, Denver, CO 80045

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-CHRFAM7A was a gift from Sherry Leonard & Henry Lester (Addgene plasmid # 62284 ; http://n2t.net/addgene:62284 ; RRID:Addgene_62284)
  • For your References section:

    The duplicated alpha7 subunits assemble and form functional nicotinic receptors with the full-length alpha7. Wang Y, Xiao C, Indersmitten T, Freedman R, Leonard S, Lester HA. J Biol Chem. 2014 Sep 19;289(38):26451-63. doi: 10.1074/jbc.M114.582858. Epub 2014 Jul 23. 10.1074/jbc.M114.582858 PubMed 25056953