lgp120+linker-pEGFP N1
(Plasmid
#62963)
-
Purposerat lgp120 + 10 amino acid linker cloned into pEGFP N1. The linker separates the targetting motif in lgp120 from EGFP.
-
Depositing Lab
-
Depositing OrganizationUniversity of Cambridge
Located in United Kingdom of Great Britain and Northern Ireland -
Publication
-
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62963 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepEGFP-N1
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namelgp120
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1281
-
Mutationhas 2 amino acid mutations compared to the coding sequence of NM_012857.2 D50E N371Y
-
GenBank IDNM_012857.2
-
Entrez GeneLamp1 (a.k.a. LGP120)
- Promoter CMV
-
Tags
/ Fusion Proteins
- linker (C terminal on insert)
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer 5’ CCAAAATCAACGGGACTTTCC 3’
- 3′ sequencing primer 5’ CAGCTTGCCGTAGGTGGC 3’
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The 10 amino acid linker was designed using the sequence as described below but with different cloning sites (EcoRI and BamHI):
Patterson GH and Lippincott-Schwartz J. (2002) A Photoactivatable GFP for Selective Photolabeling of Proteins and Cells. Science 297, 1873-1877.
Examples of use:
Jahreiss L, Menzies FM, Rubinsztein DC. (2008) The itinerary of autophagosomes: from peripheral formation to kiss-and-run fusion with lysosomes. Traffic 9: 574-587.
Renna M, Schaffner C, Winslow AR, Menzies FM, Peden AA, Floto RA, Rubinsztein DC. (2011) Autophagic substrate clearance requires activity of the syntaxin-5 SNARE complex. J Cell Sci 124:469-482.
Ogunbayo OA, Zhu Y, Shen B, Agban E, Li J, Ma J, Zhu MX, Evans AM. (2015) Organelle-specific Subunit Interactions of the Vertebrate Two-pore Channel Family. J. Biol. Chem. 290: 1086-1095.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lgp120+linker-pEGFP N1 was a gift from Paul Luzio (Addgene plasmid # 62963 ; http://n2t.net/addgene:62963 ; RRID:Addgene_62963)