pGL3-SV40P-Tet1 enhancer E
(Plasmid
#63880)
-
PurposeLuciferase reporter plasmid used to study transcriptional control of murine Tet1
-
Depositing Lab
-
Depositing OrganizationKatholieke Universiteit Leuven
Located in Belgium -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 63880 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 63880-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 63880-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL3-Promoter
- Backbone size w/o insert (bp) 5005
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTet1 enhancer fragment E
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1383
- Promoter SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer SV40pA-R
- 3′ sequencing primer RVprimer4 (GACGATAGTCATGCCCCGCG)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 63880-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 63880-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-SV40P-Tet1 enhancer E was a gift from Kian Peng Koh (Addgene plasmid # 63880 ; http://n2t.net/addgene:63880 ; RRID:Addgene_63880) -
For your References section:
Dynamic switching of active promoter and enhancer domains regulates Tet1 and Tet2 expression during cell state transitions between pluripotency and differentiation. Sohni A, Bartoccetti M, Khoueiry R, Spans L, Vande Velde J, De Troyer L, Pulakanti K, Claessens F, Rao S, Koh KP. Mol Cell Biol. 2015 Mar 15;35(6):1026-42. doi: 10.1128/MCB.01172-14. Epub 2015 Jan 12. 10.1128/MCB.01172-14 PubMed 25582196
Map uploaded by the depositor.
