Skip to main content

pGL3-SV40P-Tet2 enhancer H1
(Plasmid #63883)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 63883 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 63883-D50 50 μg of DNA in Tris buffer $495
DNA 63883-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGL3-Promoter
  • Backbone size w/o insert (bp) 5005
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tet2 enhancer fragment H1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1148
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer SV40pA-R
  • 3′ sequencing primer RVprimer4 (GACGATAGTCATGCCCCGCG)
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-SV40P-Tet2 enhancer H1 was a gift from Kian Peng Koh (Addgene plasmid # 63883 ; http://n2t.net/addgene:63883 ; RRID:Addgene_63883)
  • For your References section:

    Dynamic switching of active promoter and enhancer domains regulates Tet1 and Tet2 expression during cell state transitions between pluripotency and differentiation. Sohni A, Bartoccetti M, Khoueiry R, Spans L, Vande Velde J, De Troyer L, Pulakanti K, Claessens F, Rao S, Koh KP. Mol Cell Biol. 2015 Mar 15;35(6):1026-42. doi: 10.1128/MCB.01172-14. Epub 2015 Jan 12. 10.1128/MCB.01172-14 PubMed 25582196