human syndecan 2 FAAF
(Plasmid
#64972)
-
PurposeConstitutive expression in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversitat de Barcelona
Located in Spain -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64972 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 64972-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 64972-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5400
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namesyndecan 2
-
SpeciesH. sapiens (human)
-
MutationY179F, S187A, S188A, Y191F
-
Entrez GeneSDC2 (a.k.a. CD362, HSPG, HSPG1, SYND2)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CMV-F
- 3′ sequencing primer BGH-rev
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloning by PCR using oligo (ccactgcttactggcatgcggcgcgcgtggatc) that links the 3' region of CMV promoter of pCDNA3 to the SDC2 signal peptide and the oligo (ctagaaggcacagtcgcagtgatctcataaaatagagacac) that links the polyadenilation site of bovine growth hormone in pcDNA3 to the 3'UTR of SDC2 (FAAF).
DNA (Catalog # 64972-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 64972-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
human syndecan 2 FAAF was a gift from Enric Espel (Addgene plasmid # 64972 ; http://n2t.net/addgene:64972 ; RRID:Addgene_64972) -
For your References section:
The PDZ-binding domain of syndecan-2 inhibits LFA-1 high-affinity conformation. Rovira-Clave X, Angulo-Ibanez M, Reina M, Espel E. Cell Signal. 2014 Jul;26(7):1489-99. doi: 10.1016/j.cellsig.2014.03.012. Epub 2014 Mar 21. 10.1016/j.cellsig.2014.03.012 PubMed 24662262