pcDNA3-PTK7DN-VSV
(Plasmid #65251)

• Purpose: Expression of VSV tagged dominant negative PTK7 in mammalian cells
• Depositing Lab: Axel Ullrich
• Depositing Organization: Max Planck Institute of Biochemistry
  Located in Germany
• Publication: Gartner et al PLoS One. 2014 Jan 7;9(1):e84472. doi: 10.1371/journal.pone.0084472. eCollection 2014.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5446
• Total vector size (bp): 7728
• Modifications to backbone: in-frame VSV tag between ApaI and XhoI sites of pcDNA3
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PTK7DN
• Alt name: CCK4DN
• Species: H. sapiens (human)
• Insert Size (bp): 2282
• Mutation: deleted AA 737-1071
• GenBank ID: NM_002821
• Entrez Gene: PTK7 (a.k.a. CCK-4, CCK4)
• Promoter: CMV
• Tag / Fusion Protein:
  • VSV (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CACTGCTTACTGGCTTATCG
• 3′ sequencing primer: TGGCAACTAGAAGGCACAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Insert codes for extracellular and transmembrane domains of PTK7.

DNA (Catalog # 65251-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 65251-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.