Skip to main content

pcDNA3-PTK7DN-VSV
(Plasmid #65251)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65251 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 65251-D50 50 μg of DNA in Tris buffer $495
DNA 65251-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 7728
  • Modifications to backbone
    in-frame VSV tag between ApaI and XhoI sites of pcDNA3
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PTK7DN
  • Alt name
    CCK4DN
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2282
  • Mutation
    deleted AA 737-1071
  • GenBank ID
    NM_002821
  • Entrez Gene
    PTK7 (a.k.a. CCK-4, CCK4)
  • Promoter CMV
  • Tag / Fusion Protein
    • VSV (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CACTGCTTACTGGCTTATCG
  • 3′ sequencing primer TGGCAACTAGAAGGCACAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert codes for extracellular and transmembrane domains of PTK7.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-PTK7DN-VSV was a gift from Axel Ullrich (Addgene plasmid # 65251 ; http://n2t.net/addgene:65251 ; RRID:Addgene_65251)
  • For your References section:

    PTK 7 is a transforming gene and prognostic marker for breast cancer and nodal metastasis involvement. Gartner S, Gunesch A, Knyazeva T, Wolf P, Hogel B, Eiermann W, Ullrich A, Knyazev P, Ataseven B. PLoS One. 2014 Jan 7;9(1):e84472. doi: 10.1371/journal.pone.0084472. eCollection 2014. PONE-D-13-22093 [pii] PubMed 24409301