Skip to main content

pTre-Tight-luciferase-GFP (467)
(Plasmid #65491)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 65491 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 65491-D50 50 μg of DNA in Tris buffer $495
DNA 65491-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pTre-tight-SV40-luciferase
  • Backbone manufacturer
    Guigo lab, Addgene plasmid 65489
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Insert Size (bp)
    734
  • Promoter tight TRE promoter

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer C328F AGGCGTATCACGAGGCCCTTTCGT
  • 3′ sequencing primer C328R TATTACCGCCTTTGAGTGAGCTGA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Compared to the provided full plasmid sequence, Addgene's quality control sequencing finds an L27F amino acid residue substitution in the EGFP fluorophore. The depositing laboratory is aware of this residue change, and it does not affect fluorophore function.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTre-Tight-luciferase-GFP (467) was a gift from Roderic Guigo & Rory Johnson (Addgene plasmid # 65491 ; http://n2t.net/addgene:65491 ; RRID:Addgene_65491)