Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pETM6-FAS
(Plasmid #49810)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49810 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pETM6
  • Backbone size w/o insert (bp) 5203
  • Total vector size (bp) 10152
  • Modifications to backbone
    See paper.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    fatty acyl-ACP thioesterase
  • Alt name
    CnFatB2
  • Species
    Cocos nucifera
  • Insert Size (bp)
    1272
  • Mutation
    Codon-optmized. See supplemental information of paper.
  • GenBank ID
    AEM72520.1
  • Promoter T7

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer TGGTTGCGTCTATTGCC
  • 3′ sequencing primer GTCGGACCCATATTGCCCAGA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    hydroxydecanoyl-ACP dehydratase
  • Alt name
    fabA
  • Species
    E. coli K-12
  • Insert Size (bp)
    519
  • GenBank ID
    CDJ71394.1
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GGTAGATAAACGCGAATCCTA
  • 3′ sequencing primer CAGAAGGCAGACGTATCCTGG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    b-ketoacyl-ACP synthase III
  • Alt name
    fabH
  • Species
    E. coli K-12
  • Insert Size (bp)
    954
  • GenBank ID
    EG10277
  • Promoter T7

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CACGAAGATTATTGGCACG
  • 3′ sequencing primer AACGCACCAGAGCAGAAC
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    3-ketoacyl-ACP reductase
  • Alt name
    fabG
  • Species
    E. coli K-12
  • Insert Size (bp)
    735
  • GenBank ID
    CDJ71528.1
  • Promoter T7

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ATCGCACTGGTAACCGG
  • 3′ sequencing primer CAGACCATGTACATCCCGC
  • (Common Sequencing Primers)

Gene/Insert 5

  • Gene/Insert name
    enoyl-(acyl carrier protein) reductase
  • Alt name
    fabI
  • Species
    E. coli K-12
  • Insert Size (bp)
    789
  • GenBank ID
    CDJ71704.1
  • Promoter T7

Cloning Information for Gene/Insert 5

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GGGTTTTCTTTCCGGTAAGCGC
  • 3′ sequencing primer CAGTTCGAGTTCGTTCATTGC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETM6-FAS was a gift from Mattheos Koffas (Addgene plasmid # 49810 ; http://n2t.net/addgene:49810 ; RRID:Addgene_49810)
  • For your References section:

    Modular optimization of multi-gene pathways for fatty acids production in E. coli. Xu P, Gu Q, Wang W, Wong L, Bower AG, Collins CH, Koffas MA. Nat Commun. 2013;4:1409. doi: 10.1038/ncomms2425. 10.1038/ncomms2425 PubMed 23361000