Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pACM4-ACA
(Plasmid #49809)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 49809 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pACM4
  • Backbone size w/o insert (bp) 3956
  • Total vector size (bp) 9262
  • Modifications to backbone
    See paper.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    ACP transacylase
  • Alt name
    fabD
  • Species
    E. coli
  • Insert Size (bp)
    930
  • Mutation
    Silent site-directed mutagenesis to remove SalI site (GTCGAC to GTGGAC)
  • GenBank ID
    CDJ71527.1
  • Promoter T7

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GACGCAATTTGCATTTGTGTTCC
  • 3′ sequencing primer GAGATGTTCTACGCCTTGCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Acetyl-CoA carboxylase
  • Alt name
    accA
  • Species
    E. coli K-12
  • Insert Size (bp)
    957
  • GenBank ID
    CDJ70765.1
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CGGTTAGCCGTCAGGATGAG
  • 3′ sequencing primer CGCGTAACCGTAGCTCATC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    acetyl-CoA carboxylase
  • Alt name
    accB
  • Species
    E. coli K-12
  • Insert Size (bp)
    468
  • GenBank ID
    CDJ73611.1
  • Promoter T7

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CTGATCGAGCTGGTTGAAG
  • 3′ sequencing primer TTACTCGATGACGACCAGC
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    Acetyl-CoA carboxylase
  • Alt name
    accC
  • Species
    E. coli
  • Insert Size (bp)
    1347
  • GenBank ID
    CDJ73610.1
  • Promoter T7

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GTTATTGCCAACCGCGG
  • 3′ sequencing primer CCAGATAGTGGATGTTAGTGCC
  • (Common Sequencing Primers)

Gene/Insert 5

  • Gene/Insert name
    Acetyl-CoA carboxylase
  • Alt name
    accD
  • Species
    E. coli K-12
  • Insert Size (bp)
    912
  • GenBank ID
    CDJ72671.1
  • Promoter T7

Cloning Information for Gene/Insert 5

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GCAACATTACTCCCACCCG
  • 3′ sequencing primer CAGGCCTCAGGTTCCTGATC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACM4-ACA was a gift from Mattheos Koffas (Addgene plasmid # 49809 ; http://n2t.net/addgene:49809 ; RRID:Addgene_49809)
  • For your References section:

    Modular optimization of multi-gene pathways for fatty acids production in E. coli. Xu P, Gu Q, Wang W, Wong L, Bower AG, Collins CH, Koffas MA. Nat Commun. 2013;4:1409. doi: 10.1038/ncomms2425. 10.1038/ncomms2425 PubMed 23361000