pCDM4-GLY
(Plasmid
#49808)
-
PurposeEncodes pgk, gapA, aceE, aceF, lpdA in pseudo-operon configuration.
-
Depositing Lab
-
Depositing OrganizationRensselaer Polytechnic Institute
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 49808 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCDM4
- Backbone size w/o insert (bp) 3810
- Total vector size (bp) 12630
-
Modifications to backboneSee paper.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namephosphoglycerate kinase
-
Alt namepgk
-
SpeciesEscherichia coli
-
Insert Size (bp)1164
-
GenBank IDCDJ73916.1
- Promoter T7
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GTCTGTAATTAAGATGACCGATCTGG
- 3′ sequencing primer CTTCTTAGCGCGCTCTTCG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameglyceraldehyde-3-phosphate dehydrogenase
-
Alt namegapA
-
SpeciesE. coli K-12
-
Insert Size (bp)996
-
GenBank IDCDJ72173.1
- Promoter T7
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GTAGGTATCAACGGTTTTGGCC
- 3′ sequencing primer GGAGATGTGAGCGATCAGGTC
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namepyruvate dehydrogenase subunit E1
-
Alt nameaceE
-
SpeciesE. coli K-12
-
Insert Size (bp)2664
-
GenBank IDCDJ70695.1
- Promoter T7
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GTCAGAACGTTTCCCAAATGACG
- 3′ sequencing primer CCAGACGCGGGTTAACTTTATC
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namedihydrolipoamide acetyltransferase
-
Alt nameaceF
-
SpeciesE. coli
-
Insert Size (bp)1893
-
GenBank IDCDJ70696.1
- Promoter T7
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GGCTATCGAAATCAAAGTACC
- 3′ sequencing primer CATCACCAGACGGCGAATG
- (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert namedihydrolipoamide dehydrogenase
-
Alt namelpdA
-
SpeciesE. coli K-12
-
Insert Size (bp)1145
-
GenBank IDCDJ70697.1
- Promoter T7
Cloning Information for Gene/Insert 5
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CTCAGGTCGTGGTACTTGG
- 3′ sequencing primer CTTCTTCTTCGCTTTCGGGTTC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDM4-GLY was a gift from Mattheos Koffas (Addgene plasmid # 49808 ; http://n2t.net/addgene:49808 ; RRID:Addgene_49808) -
For your References section:
Modular optimization of multi-gene pathways for fatty acids production in E. coli. Xu P, Gu Q, Wang W, Wong L, Bower AG, Collins CH, Koffas MA. Nat Commun. 2013;4:1409. doi: 10.1038/ncomms2425. 10.1038/ncomms2425 PubMed 23361000