pTre-Tight-luciferase-GFP (467)
(Plasmid
#65491)
-
Purposenegative control for expression assays
-
Depositing Labs
-
Depositing OrganizationCentre for Genomic Regulation (CRG)
Located in Spain -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65491 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 65491-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 65491-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTre-tight-SV40-luciferase
-
Backbone manufacturerGuigo lab, Addgene plasmid 65489
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEGFP
-
Insert Size (bp)734
- Promoter tight TRE promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer C328F AGGCGTATCACGAGGCCCTTTCGT
- 3′ sequencing primer C328R TATTACCGCCTTTGAGTGAGCTGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: Compared to the provided full plasmid sequence, Addgene's quality control sequencing finds an L27F amino acid residue substitution in the EGFP fluorophore. The depositing laboratory is aware of this residue change, and it does not affect fluorophore function.
DNA (Catalog # 65491-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 65491-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTre-Tight-luciferase-GFP (467) was a gift from Roderic Guigo & Rory Johnson (Addgene plasmid # 65491 ; http://n2t.net/addgene:65491 ; RRID:Addgene_65491)