pDRFLIP35
(Plasmid
#65513)
-
Purpose(Empty Backbone) FRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65513 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDR196
- Backbone size (bp) 6400
-
Modifications to backboneNone
-
Vector typeYeast Expression
- Promoter pPMA1
-
Selectable markersURA3
-
Tags
/ Fusion Proteins
- 6His-AFPt9-attR1
- attR2-TFPt9-cMyc
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ACAAGTTTGTACAAAAAAGCA
- 3′ sequencing primer ACCACTTTGTACAAGAAAGCTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDRFLIP35 was a gift from Wolf Frommer (Addgene plasmid # 65513 ; http://n2t.net/addgene:65513 ; RRID:Addgene_65513) -
For your References section:
Abscisic acid dynamics in roots detected with genetically encoded FRET sensors. Jones AM, Danielson JA, Manojkumar SN, Lanquar V, Grossmann G, Frommer WB. eLife. 2014 Apr 15;3:e01741. doi: 10.7554/eLife.01741. PubMed 24737862