pcDNA3.2-C11orf83-V5
(Plasmid
#65843)
-
PurposeMammalian expression of C terminally V5-tagged C11orf83/UQCC3
-
Depositing Lab
-
Depositing OrganizationUniversity of Geneva
Located in Switzerland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 65843 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 65843-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 65843-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCDNA 3.2
-
Backbone manufacturerLife technologies
- Total vector size (bp) 5832
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUQCC3 WT
-
Alt nameC11orf83
-
SpeciesH. sapiens (human)
-
MutationWT
-
GenBank IDNM_001085372.2
-
Entrez GeneUQCC3 (a.k.a. C11orf83, CCDS41658.1, MC3DN9, UNQ655)
-
Tag
/ Fusion Protein
- V5 (C terminal on insert)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer CACCATGGATTCCTTGCGGAAAATGCTGATCTC
- 3′ sequencing primer CGGTGACCTCCCGCCGGCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 65843-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 65843-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.2-C11orf83-V5 was a gift from Amos Bairoch (Addgene plasmid # 65843 ; http://n2t.net/addgene:65843 ; RRID:Addgene_65843) -
For your References section:
C11orf83, a mitochondrial cardiolipin-binding protein involved in bc1 complex assembly and supercomplex stabilization. Desmurs M, Foti M, Raemy E, Vaz FM, Martinou JC, Bairoch A, Lane L. Mol Cell Biol. 2015 Apr;35(7):1139-56. doi: 10.1128/MCB.01047-14. Epub 2015 Jan 20. 10.1128/MCB.01047-14 PubMed 25605331