-
PurposeExpression of constitutively active murine PDGFRalpha D842V tagged with GFP under the control of EF1a promoter
-
Depositing Lab
-
Depositing OrganizationUniversity of Copenhagen
Located in Denmark -
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 66789 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 66789-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 66789-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA5FRT
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePDGFRalpha
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)4049
-
MutationD842V (constitutively active)
-
GenBank IDNM_001083316.1
-
Entrez GenePdgfra (a.k.a. CD140a, Pdgfr-2)
- Promoter EF1a
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer EF-1a-F (TCAAGCCTCAGACAGTGGTTC)
- 3′ sequencing primer BGH-rev
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 66789-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 66789-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5FRT-EF-Pdgfralpha-EGFPN D842V was a gift from Lotte Pedersen (Addgene plasmid # 66789 ; http://n2t.net/addgene:66789 ; RRID:Addgene_66789) -
For your References section:
PDGFRbeta and oncogenic mutant PDGFRalpha D842V promote disassembly of primary cilia through a PLCgamma- and AURKA-dependent mechanism. Nielsen BS, Malinda RR, Schmid FM, Pedersen SF, Christensen ST, Pedersen LB. J Cell Sci. 2015 Oct 1;128(19):3543-9. doi: 10.1242/jcs.173559. Epub 2015 Aug 19. 10.1242/jcs.173559 PubMed 26290382
Map uploaded by the depositor.