PNCA-mCherry
(Plasmid
#67790)
-
PurposeExpression of MMLV proviral DNA-mCherry. Use together with pCMV-intron and VSV-G to package MMLV reporter virus
-
Depositing Lab
-
Depositing OrganizationColumbia University
Located in United States of America -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 67790 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepNCA
-
Backbone manufacturerAddgene Plasmid 17363
- Backbone size w/o insert (bp) 8000
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMMLV-LTR-mCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer Amp-R (ATAATACCGCGCCACATAGC)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PNCA-mCherry was a gift from Stephen Goff (Addgene plasmid # 67790 ; http://n2t.net/addgene:67790 ; RRID:Addgene_67790) -
For your References section:
Silencing of proviruses in embryonic cells: efficiency, stability and chromatin modifications. Schlesinger S, Goff SP. EMBO Rep. 2013 Jan;14(1):73-9. doi: 10.1038/embor.2012.182. Epub 2012 Nov 16. 10.1038/embor.2012.182 PubMed 23154467