Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

PNCA-GFP
(Plasmid #67789)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 67789 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pNCA
  • Backbone manufacturer
    Addgene Plasmid 17363
  • Backbone size w/o insert (bp) 8000

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MMLV-LTR-GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer Amp-R (ATAATACCGCGCCACATAGC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PNCA-GFP was a gift from Stephen Goff (Addgene plasmid # 67789 ; http://n2t.net/addgene:67789 ; RRID:Addgene_67789)
  • For your References section:

    Dynamic instability of genomic methylation patterns in pluripotent stem cells. Ooi SK, Wolf D, Hartung O, Agarwal S, Daley GQ, Goff SP, Bestor TH. Epigenetics Chromatin. 2010 Sep 24;3(1):17. doi: 10.1186/1756-8935-3-17. 10.1186/1756-8935-3-17 PubMed 20868487