Skip to main content

pCS6-YFP-SMASh
(Plasmid #68853)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 68853 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 68853-D50 50 μg of DNA in Tris buffer $495
DNA 68853-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCS6
  • Backbone size w/o insert (bp) 6622
  • Total vector size (bp) 8260
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    YFP-SMASh
  • Species
    HCV, Aequorea victoria
  • Insert Size (bp)
    1638
  • Promoter CMV
  • Tag / Fusion Protein
    • SMASh tag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATTTAGGTGACACTATAG
  • 3′ sequencing primer CAGGCTGGGTCCTGTCACTGGCTAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS6-YFP-SMASh was a gift from Michael Lin (Addgene plasmid # 68853 ; http://n2t.net/addgene:68853 ; RRID:Addgene_68853)
  • For your References section:

    Tunable and reversible drug control of protein production via a self-excising degron. Chung HK, Jacobs CL, Huo Y, Yang J, Krumm SA, Plemper RK, Tsien RY, Lin MZ. Nat Chem Biol. 2015 Jul 27. doi: 10.1038/nchembio.1869. 10.1038/nchembio.1869 PubMed 26214256