-
PurposeExpresses Venus YFP with a C-terminal SMASh(AI) tag fusion in mammalian cells. [AI = asunaprevir inhibited].
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111500 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 111500-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 111500-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV-SPORT6
-
Backbone manufacturerInvitrogen
- Total vector size (bp) 8340
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameYFP-SMASh(AI)
-
SpeciesAequorea victoria, Hepatitis C Virus (HCV) genotype 1a
-
Insert Size (bp)1758
-
MutationThe HCV NS3 protease carries V36M, T54A, and S122G mutations.
-
GenBank IDNC_004102
- Promoter CMV
-
Tags
/ Fusion Proteins
- SMASh tag (C terminal on insert)
- HA epitope tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTTAGGTGACACTATAG
- 3′ sequencing primer CCTAGTTGGCAAAAGCCACA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bythe Michael Lin lab [SMASh tag, Ref. 1], and the Atsushi Miyawaki lab [Venus YFP, Ref. 2].
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
[Ref. 1]
CHUNG H.K., JACOBS C.L., HUO Y., YANG J., KRUMM S.A., PLEMPER R.K., TSIEN R.Y. & LIN M.Z. 2015. Tunable and reversible drug control of protein production via a self-excising degron. Nat Chem Biol 11: 713-720.
[Ref. 2]
NAGAI T., IBATA K., PARK E.S., KUBOTA M., MIKOSHIBA K. & MIYAWAKI A. 2002. A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat Biotechnol 20: 87-90.
DNA (Catalog # 111500-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 111500-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS6-YFP-SMASh(AI) was a gift from Michael Lin (Addgene plasmid # 111500 ; http://n2t.net/addgene:111500 ; RRID:Addgene_111500) -
For your References section:
StaPLs: versatile genetically encoded modules for engineering drug-inducible proteins. Jacobs CL, Badiee RK, Lin MZ. Nat Methods. 2018 Jul;15(7):523-526. doi: 10.1038/s41592-018-0041-z. Epub 2018 Jul 2. 10.1038/s41592-018-0041-z PubMed 29967496