pCS6-StaPLd-Casp9
(Plasmid
#111511)
-
PurposeExpresses a tandem caspase-9 dimer, governed by a StaPL(AI) module, in mammalian cells. [AI = asunaprevir inhibited].
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111511 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 111511-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 111511-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV-SPORT6
-
Backbone manufacturerInvitrogen
- Total vector size (bp) 6801
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameStaPLd-Casp9
-
SpeciesH. sapiens (human); Hepatitis C Virus (HCV) genotype 1a
-
Insert Size (bp)2457
-
MutationThe HCV NS3 protease carries V36M, T54A, and S122G mutations. Both caspase-9 copies have had their N termini truncated.
-
GenBank IDNC_004102
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACAGCTATGACCATTAGGCCT
- 3′ sequencing primer GTTGTAAAACGACGGCCAGT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bythe Guy Salvesen lab [Caspase-9, Ref. 1]
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
[Ref. 1]
STENNICKE H.R., DEVERAUX Q.L., HUMKE E.W., REED J.C., DIXIT V.M. & SALVESEN G.S. 1999. Caspase-9 can be activated without proteolytic processing. J Biol Chem 274: 8359-8362.
DNA (Catalog # 111511-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 111511-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS6-StaPLd-Casp9 was a gift from Michael Lin (Addgene plasmid # 111511 ; http://n2t.net/addgene:111511 ; RRID:Addgene_111511) -
For your References section:
StaPLs: versatile genetically encoded modules for engineering drug-inducible proteins. Jacobs CL, Badiee RK, Lin MZ. Nat Methods. 2018 Jul;15(7):523-526. doi: 10.1038/s41592-018-0041-z. Epub 2018 Jul 2. 10.1038/s41592-018-0041-z PubMed 29967496