Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCS6-StaPLd-Casp9
(Plasmid #111511)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 111511 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCMV-SPORT6
  • Backbone manufacturer
    Invitrogen
  • Total vector size (bp) 6801
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    StaPLd-Casp9
  • Species
    H. sapiens (human); Hepatitis C Virus (HCV) genotype 1a
  • Insert Size (bp)
    2457
  • Mutation
    The HCV NS3 protease carries V36M, T54A, and S122G mutations. Both caspase-9 copies have had their N termini truncated.
  • GenBank ID
    NC_004102
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACAGCTATGACCATTAGGCCT
  • 3′ sequencing primer GTTGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    the Guy Salvesen lab [Caspase-9, Ref. 1]
  • Terms and Licenses

Depositor Comments

[Ref. 1]
STENNICKE H.R., DEVERAUX Q.L., HUMKE E.W., REED J.C., DIXIT V.M. & SALVESEN G.S. 1999. Caspase-9 can be activated without proteolytic processing. J Biol Chem 274: 8359-8362.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS6-StaPLd-Casp9 was a gift from Michael Lin (Addgene plasmid # 111511 ; http://n2t.net/addgene:111511 ; RRID:Addgene_111511)
  • For your References section:

    StaPLs: versatile genetically encoded modules for engineering drug-inducible proteins. Jacobs CL, Badiee RK, Lin MZ. Nat Methods. 2018 Jul;15(7):523-526. doi: 10.1038/s41592-018-0041-z. Epub 2018 Jul 2. 10.1038/s41592-018-0041-z PubMed 29967496