Skip to main content

pCS6-StaPLd-Casp9
(Plasmid #111511)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111511 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 111511-D50 50 μg of DNA in Tris buffer $495
DNA 111511-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCMV-SPORT6
  • Backbone manufacturer
    Invitrogen
  • Total vector size (bp) 6801
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    StaPLd-Casp9
  • Species
    H. sapiens (human); Hepatitis C Virus (HCV) genotype 1a
  • Insert Size (bp)
    2457
  • Mutation
    The HCV NS3 protease carries V36M, T54A, and S122G mutations. Both caspase-9 copies have had their N termini truncated.
  • GenBank ID
    NC_004102
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACAGCTATGACCATTAGGCCT
  • 3′ sequencing primer GTTGTAAAACGACGGCCAGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    the Guy Salvesen lab [Caspase-9, Ref. 1]

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

[Ref. 1]
STENNICKE H.R., DEVERAUX Q.L., HUMKE E.W., REED J.C., DIXIT V.M. & SALVESEN G.S. 1999. Caspase-9 can be activated without proteolytic processing. J Biol Chem 274: 8359-8362.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS6-StaPLd-Casp9 was a gift from Michael Lin (Addgene plasmid # 111511 ; http://n2t.net/addgene:111511 ; RRID:Addgene_111511)
  • For your References section:

    StaPLs: versatile genetically encoded modules for engineering drug-inducible proteins. Jacobs CL, Badiee RK, Lin MZ. Nat Methods. 2018 Jul;15(7):523-526. doi: 10.1038/s41592-018-0041-z. Epub 2018 Jul 2. 10.1038/s41592-018-0041-z PubMed 29967496