Skip to main content
Addgene
Open Menu

Cx43K258stop-msfGFP
(Plasmid #69023)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69023 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 69023-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 69023-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    EGFP-N1
  • Total vector size (bp) 5518
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cx43
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    768
  • Mutation
    delete codons 258-381 and fuse in frame to monomeric superfolder GFP
  • Entrez Gene
    Gja1 (a.k.a. Cx43, Cxnk1)
  • Promoter CMV
  • Tag / Fusion Protein
    • V206K monomerized super folder GFP (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CMV
  • 3′ sequencing primer C1N1-rev: ACCTCTACAAATGTGGTATGGCTGATTATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addition of a fluorescent protein tag to the carboxyl-terminus of Cx43 has been shown to eliminate or attenuate interactions with ZO-1 and Occludin in cell culture. Other binding interactions and channel gating properties may be affected.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cx43K258stop-msfGFP was a gift from David Spray (Addgene plasmid # 69023 ; http://n2t.net/addgene:69023 ; RRID:Addgene_69023)

  • For your References section:

    Connexin Type and Fluorescent Protein-fusion Tag Determine Structural Stability of Gap Junction Plaques. Stout RF Jr, Snapp EL, Spray DC. J Biol Chem. 2015 Aug 11. pii: jbc.M115.659979. 10.1074/jbc.M115.659979 PubMed 26265468
Related items:
Commonly requested with: