Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Cx43-msfGFP
(Plasmid #69007)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69007 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    EGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4733
  • Total vector size (bp) 5893
  • Modifications to backbone
    EGFP replaced with sfGFP and the V207 in sfGFP mutagenized to K with PCR cloning to monomerize.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gja1
  • Alt name
    Cx43
  • Species
    R. norvegicus (rat)
  • Entrez Gene
    Gja1 (a.k.a. Cx43, Cxnk1)
  • Promoter cmv
  • Tag / Fusion Protein
    • monomerized superfolder GFP (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CMV forward primer
  • 3′ sequencing primer ACCTCTACAAATGTGGTATGGCTGATTATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addition of a fluorescent protein tag to the carboxyl-terminus of Cx43 has been shown to eliminate or attenuate interactions with ZO-1 and Occludin in cell culture. Other binding interactions and channel gating properties may be affected.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Cx43-msfGFP was a gift from David Spray (Addgene plasmid # 69007 ; http://n2t.net/addgene:69007 ; RRID:Addgene_69007)
  • For your References section:

    Connexin Type and Fluorescent Protein-fusion Tag Determine Structural Stability of Gap Junction Plaques. Stout RF Jr, Snapp EL, Spray DC. J Biol Chem. 2015 Aug 11. pii: jbc.M115.659979. 10.1074/jbc.M115.659979 PubMed 26265468