TDG004_pLenti_CMVtight_Kir2.1_CFP
(Plasmid #178820)

• Purpose: tet-on expression of an inward-rectifier potassium channel Kir2.1 carrying an CFP tag
• Depositing Lab: Adam Cohen
• Publication: Tian et al Nat Methods. 2023 Jul;20(7):1082-1094. doi: 10.1038/s41592-022-01743-5. Epub 2023 Jan 9.

Backbone

• Vector backbone: pLenti
• Total vector size (bp): 10015
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Kir2.1_CFP
• Species: M. musculus (mouse)
• Insert Size (bp): 2046
• GenBank ID: kir2.1 NM_008425.4
• Promoter: CMV
• Tag / Fusion Protein:
  • CFP (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CMV-forward: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: WPRE-R: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • TDG004 pLenti CMVtight Kir2.1 CFP Neo.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2021.11.22.469481 for bioRxiv preprint.